What is gene editing?

GENE EDITING What is gene editing and how does it work? Gene editing allows scientists to change gene sequences by adding, replacing or removing sections of DNA. https://youtu.be/XPDb8tqg

From Bench to Bedside: Targeted Gene Editing

Sequence DNA for Yourself — NOVA | PBS

SOLVED: The DNA sequence below is of a very short, protein-coding gene. The displayed sequence is from the transcription start site to the end of transcription. It contains an intron, which is shown in bold. Ignore the underlined € G base pair. 5'  CTACGTACTAGCTATTCCGATCTATAC TCGATCTAGTCGCATTCCGATTCGATCGTAC-3  GATGCATGATCGA TAAGGCTAGATATGAGCTAGATCAGCGTAAGGCTAAGCTAGCATG-5' Which strand is used as a template and how many amino acids does the open reading frame encode.? A: Bottom strand, 4 amino

Record-breaking DNA sequencing offers hope to those with rare diseases. Here's how

Sequencing 101: The Evolution of DNA Sequencing Tools